thanks

12 May, 2007 by Robert Jarvis

three.jpg

With the audio box now installed, my sound installation is now complete.  It has been running now at the garden for over a week, in rain, wind and sunshine and everything seems to be working as it should.  After such a long project it feels good to have come to an end as now my mind can rest (before turning to my next project – for La Cité des Insectes).

Thanks to everyone who helped me along my way with this project, offering support and guidance: – to Murray Beeson, Graham Calvert, Mark Chase, Georges Dussart, Jony Easterby, Nathalie Farriol-Mathis, Charlotte Gardiner, Steve Gibbs (Outdoor Audio Company) , Penny King, Bernie Krause, Anthony Paul, Hannah Peschar, Charlotte Ray, Carla Scaletti, Siobhán Timoney, Martin Trick, Andy Turner, and of course to Mole Valley District Council, The PRS Foundation and The Arts Council of England.

END OF BLOG

audio box

30 April, 2007 by Robert Jarvis

audiobox.jpg

The sound for the installation will be ‘played’ from a specially made audio box capable of playing and amplifying four synchronised channels of audio to be sent to the loudspeakers around the pond.  The device turns on and automatically begins playing when the garden’s electricity is turned on in the mornings, and then loops until the power is switched off.

The compositions are designed to be listened to ambiently, i.e., at a volume level that is in balance with the garden’s natural soundscape.   In total I have composed four pieces that take their inspiration from four of the plants around the pond: acer palmatum (Japanese Maple Tree), arundinaria murielae (Umbrella Bamboo), halesia carolina (Silverbell Tree) and gunnera manicata (Gunnera).  The compositions draw from genetic material derived from the relevant plant species and are arranged pairs, separated by a fifteen minute silence.  In total, the looped composition is one hour in length. 

final mix

25 April, 2007 by Robert Jarvis

capybara.jpg

After spending the last four weeks in the studio concentrating on completing my various compositions, it has been a real pleasure to spend a few days at the sculpture garden working on the final mixes for my installation.  Fortunately, this time, the weather was sunny (and quiet) and so I was able to make the necessary fine adjustments for the garden’s natural soundscape as well as for the speakers and the spatialisation of the sound.

gr0w

31 March, 2007 by Robert Jarvis

12-speaker-plant.jpg

Spent yesterday in the rain and mud ’planting’ the loudspeakers from which the sound will come from when the installation is up and running.  The biggest (and messiest) job though was running the audio cable around the oriental pond and then concealing the leads by burying them.  My plan is that by May, when the installation will be launched, both speakers and cable will be covered by the growing plants and will therefore not detract from the visual beauty of the location.

composition process

29 March, 2007 by Robert Jarvis

three-growth.jpg

Spring has definitely arrived now; however all my energy is currently on the creation of musical pieces inspired by the amino acid and dna sequences of various plants in the garden situated around the Oriental Pond. 

Each composition is taking me a full week to do, beginning with collecting the genomic data from the EBI and Entrez databases and then finding out general information about the plant in question.  Based on this, I then choose a musical scale or tonality to base the composition on and attribute the scientific data to, and then work to create the actual sounds that will be used.  After this, it is a matter of making musical choices and sonic manipulations to create something which sounds ‘pleasing’ and yet has an identity which retains a connection to the original data.

An interesting challenge is trying to visualise how the final work will sound to visitors to the garden.  Whilst in my studio I sit in the midst of a surround sound set up, the final composition will be listened to from outside of the listening circle as the speakers will be placed around the pond.

acid music

19 February, 2007 by Robert Jarvis

09-bark.JPG

As DNA strings consist of solely four elements (A, C, G & T) I have been encoding the DNA for various plants in the garden into their respective Amino Acid sequences.  There are twenty Amino Acids and so there is a wider variation of data, and the result is something that sounds more musical. 

In order to help decide which amino acids should be assigned to which notes, I have ordered them according to their molecular weight (Trp, Tyr, Arg, Phe, His, Met, Glu, Lys, Gln, Asp, Asn, Leu, Ile, Cys, Thr, Val, Pro, Ser, Ala & Gly) with the heaviest being the lowest notes and lightest the higher notes.  As regards the notes themselves, I have been assigning these to musical scales from the country of origin of each plant.

Here is an example midifile for the Japanese Maple Tree (Acer Palmatum) with each Amino Acid assigned to a note on the Yona Nuki Minor Scale.

musical dna

28 January, 2007 by Robert Jarvis

dna

I am currently experimenting with sonifying the DNA strings of various plants in the garden.  Because of the repetition in the data the effect can sound quite musical.  As an example, here is what one of the gardens plants (Indian Bean Tree) sounds like:  LISTEN.

And here’s the DNA data: -

GAATCAATCCTACTACTTCTGGTTCNNNNGNNNCCACGCTTGAAAAAAAAAACC TGGGGCGTATCGTCCAAATCATCGGTCCGGTAMTAGATGTAGCCTTTCCGCCGG GCAAGATGCCTAATATTTATAACGCTCTAGTAGTTAAAGGTCGAGATACTGTTG GTCAACCAATTAATGTGACTTGTGAGGTACAGCAATTATTAGGAAATAATCGAG TTAGAGCTGTAGCTATGAGTGCTACAGATGGTCTGACGAGAGGAATGGAAGTGA TTAATACGGGAGCTCCTCTAAGTGTTCCAGTCGGTGGAGCGACTCTGGGACGAA TTTTCAACGTGCTTGGAGAGGCTGTTGATAATTTAGGTCCTGTAGATACTCGTA CAACATTTCCTATTCATCGATCTGCGCCTGCCTTTATACAGTTAGATACAAAAT TATCTATTTTTGAAACAGGAATTAAAGTAGTAGATCTTTTAGCCCCTTATCGCC GTGGGGGAAAAATCGGACTATTTGGGGGAGCTGGGGTTGGTAAAACGGTACTCA TTATGGAATTGATTAACAATATTGCYAAAGCYCAYGGGGGCGTATCCGTATTTG GCGGAGTGGGTGAACGTACTCGTGAAGGAAATGATCTTTACATGGAAATGAAAG AATCTGGAGTGATTAATGAAGAAAATATTGCAGAATCAAAAGTGGCTCTAGTTT ACGGCCAGATGAATGAACCGCCAGGAGCTCGTATGAGAGTTGGTTTGACTGCCC TAACGATGGCGGAATATTTCAGAGATGTTAATGAACAAGACGTACTTCTATTTA TCGACAATATCTTCCGTTTCGTCCAAGCAGGATCCGAAGTATCGGCCTTATTGG GTAGAATGCCTTCCGCTGTCGGTTATCAACCCACCCTGAGTACCGAAATGGGCT CTTTACAAGAAAGAATTACTTCTACCAAAGAAGGGTCCATAACTTCTATTCAAG CAGTTTATGTACCCGCGGACGATTTGACCGATCCTGCTCCTGCTACGACATTTG CACATTTAGATGCTACTACCGTACTATCAAGAGGATTAGCTGCCAAAGGTATCT ATCCAGCAGTAGATCCTTTAGATTCAACTTCAACCATGCTTCAACCTCGGATCG TTGGTGAGGAACATTATGAAACTGCGCAAAGAGTTAAGCAAACTTTACAACGTT ATAAAGAGCTTCAGGACATTATAGCTATCCTTGGGTTGGACGAATTATCCGAAG AGGATCGTTTAACCGTAGCAAGAGCGCGAAAAATCGAGCGTTTCTATCACAACC TTTTTTTGTAGCCGAAGTATTTACCGGTTCTCCAGGAAAATATGTTGGTCTGGC CGAAACCATTAGAGGGTTTCAATTGATCCTTTCCGGAGAATTAGATGGGCTTCC TGAACAGGCCTTTTATTTGGTAGGTAATATCGATGAAGCTACCGCGAAGGCTAT GAACTTAGAAATG

acoustic perfume

15 January, 2007 by Robert Jarvis

hanging.JPG

Still going with the ‘wave’ concept as a structure for my musical composition (with sections slowly fading in and out) I am wondering just how subtle this could be.  Using the analogy of smell, I wonder if it might be possible to ‘perfume’ the air with different sonic fragrances: creating different moods or even altering one’s perception of the garden.

balancing act

20 December, 2006 by Robert Jarvis

07-balancing.jpg

This project is demanding a number of interesting questions relating to composition and sense of place, such as ‘what sounds are appropriate for a piece to exist outside?’, ‘how does one compose for an environment that is in a constant flux of change?’ and ‘how can a piece link to a specific space (in this case the garden)?’

Inspired by thoughts related to these questions, I am currently thinking about creating my composition in the form of a number of sections that frame the garden’s natural soundscape. One possibility is that each composed section could ‘dissolve’ in and out of the natural sounds, imperceptively beginning and ending, and thus blurring the distinction between listening to the piece itself or listening to the garden.

figure-figure

30 November, 2006 by Robert Jarvis

06-juxtapositions.jpg

The garden, of course, is not a neutral environment. Its soundscape is in a constant flux of change appropriate to the time of year. Certainly, the sounds will be different in May and over the summer (when what I create will be exhibited). This, of course, presents its own challenges as I experiment with what the final result might sound like.

Any composition can be seen as a dialogue between foreground and background. In this case, that dialogue will be between whatever it is that I compose and the setting of the garden’s summer soundscape. I am interested in making that dialogue a feature of the piece and to this end I have been experimenting with sound recordings from the garden using it as both a sound source and as an instrument.

decay

16 November, 2006 by Robert Jarvis

decay

It has been interesting to view the gradual decay of the plants in the garden as winter approaches. Ironically perhaps, this part of their cycle is arguably the most beautiful as they begin to change their colours.

Now that the life-giving nuts have fallen, it’s as if the photo-synthetic function of the leaves is no longer needed as winter approaches. On one hand, it seems odd to be in a garden engaged in a project with the working title of grow where most of the plants appear to be dying. However, the vibrant gradually changing display of the leaves implies that, actually, there is a process of growth occurring, but more on the lines of a preparation for a next stage, rather than a simple giving up and dying.

This idea of redefining ‘end’ as a ‘focusing for a new beginning’ has interesting implications for the composition and structure of what I create.

the finer detail

31 October, 2006 by Robert Jarvis

reflections

The sculpture garden rewards those who take their time to experience the finer detail of their surroundings: the plants, the sounds, the reflections in the water, the movement of the trees in the wind, and so on. The more I am here, the more it is obvious to me that the sound installation should reflect this aspect. The question is how I can connect my creation with this way of experiencing the space. In a way, I would like my installation to highlight the garden and the oriental pond area in particular: to create something that encourages visitors to view their surroundings in a more reflective way.

nature’s phrases

11 October, 2006 by Robert Jarvis

Although the garden has a relaxing feel to it, that’s not to say that it is silent. In fact, rarely does a moment pass when there isn’t something to listen to. Most of these are short in duration, and appear random, such as birdcalls; however, there is also the distant sound of speeding traffic and, every so often, a passing plane.

With the exception of the aircraft, the garden’s sounds appear to be subtle and delicate, encouraging one to listen carefully and enjoy the variations. The sound of the wind on the leaves of the different plants creeps around the garden. Each plant, with the different size branches and foliage has a subtly different sound and rhythm, and the result is an ever-changing background of white noise.

I am interested in not only the sounds that are in the garden and around the ‘Oriental Pond’ (where my installation will be finally located) but of the shape and timing of these sounds. My favourite recurring phrase at the moment is that of the wind passing through the trees, moving the branches and the leaves more and more until there is the sound of nuts hitting the ground, followed by a few leaves gently landing.

oriental pond

17 September, 2006 by Robert Jarvis

The location for my installation will be the far corner of the sculpture garden – a secluded spot that plays host to ‘The Oriental Pond’.  At the moment the pond is covered with green duckweed into which the giant leaved Gunnera Manicatas appear to melt into as they dip into the water’s edge.

This open space surrounded by trees makes a natural ampitheatre and so seems a good choice for locating the sound piece; however where it is placed exactly – in the trees, in the water or around the pond – will be decided as the project unfolds.  For this I will be influenced by how I want the piece to sound as well as the weatherproof properties of whatever audio equipment I use.

connecting

10 September, 2006 by Robert Jarvis

The first week of this project has been concerned with the connection of people, ideas and resources.

In order for me to begin my research I have been gathering resources – from specialised recording equipment through to relevant listening and reading material, as well as conversing with experts in the field. As I come across interesting links I shall reference them in this blog for those interested in gaining an insight into current thinking related to this project’s theme.

I am now looking forward to visiting the garden and to begin to connect with those in the local community.

27 July, 2006 by Robert Jarvis

GROW  is the name of a new residency and sound work that brings together sound artist Robert Jarvis and the Hannah Peschar Sculpture Garden.  From September 2006, Robert will work at the garden and in the surrounding community on the creation of a new sound installation to be exhibited from the following May as part of the garden’s 2007 public exhibition.  During the residency Robert will work with the theme of ‘Growth’ as a starting point for researching ideas for his composition.  Over the year he will learn about the plants and their histories as well as making recordings in the garden.  In the wider community, he will engage with local gardeners and also talk with people around the concept of human age in order to explore how these themes could be developed.  His proposition is that the final work will connect these areas of research to produce a piece that relates to both garden and life in general.

The project is funded by Arts Council England, the Performing Right Society Foundation and Mole Valley District Council.